Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.068639 |
Chromosome: | chromosome 2 |
Location: | 4116076 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g103550 | EIF1A | Eukaryotic translation initiation factor 1A, eIF-1A; (1 of 1) K03236 - translation initiation factor 1A (EIF1A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGAGTGCAAATTACTGGAGTGGCTCCGTGCTCCCTCGCTGCGCGTCTA |
Internal bar code: | AGACGTACACATTAGGAAGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 909 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTAGGCAACCCTGAACACG |
Suggested primer 2: | CGAGTCCGATACTGACCGTG |