| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.068696 |
| Chromosome: | chromosome 16 |
| Location: | 5870623 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679500 | NUOB8 | (1 of 1) K03946 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 2 (NDUFA2); NADH:ubiquinone oxidoreductase 11 kDa subunit | 3'UTR |
| Cre16.g679550 | FAP277 | Flagellar Associated Protein 277; (1 of 1) K13963 - serpin B (SERPINB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTATTTGCTTAAGTACTACGGACCACTCATCGAAAGGTTAACCCGCAA |
| Internal bar code: | TGGACGCATATTGCCTATTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2819 |
| LEAP-Seq percent confirming: | 75.3425 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGGCCCAGCTTTAAGTG |
| Suggested primer 2: | TGGATGCATCGATGGTACGG |