| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.068744 |
| Chromosome: | chromosome 17 |
| Location: | 1699526 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g708100 | (1 of 3) 2.4.2.8 - Hypoxanthine phosphoribosyltransferase / Transphosphoribosidase; Similar to Hypoxanthine-Guanine | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGCTAGAAGAAAGATAATACACATGGCTTAGTGAGCCAGTAAAACATT |
| Internal bar code: | TTTATCATTGGTCGATACGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3442 |
| LEAP-Seq percent confirming: | 95.082 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGTACATGCGGTTCGGT |
| Suggested primer 2: | ATCTTTCCTCACTGGTGCCG |