| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.068750 |
| Chromosome: | chromosome 7 |
| Location: | 4187656 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342150 | GluTR,HEM1,HEMA,GTR,GLTR1 | (1 of 1) 1.2.1.70 - Glutamyl-tRNA reductase; Glutamyl-tRNA reductase 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGTGTGTGAAGGGCGGATTGAATAATTAATGGCGGCGGCGCTGAGAT |
| Internal bar code: | AACCTCGGCTGAGCCTTCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 368 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGCGCCATATACCAGTT |
| Suggested primer 2: | CAACACGTGCTTGGACTGTG |