| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.068761 |
| Chromosome: | chromosome 17 |
| Location: | 6543385 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g744847 | SEC6 | (1 of 1) K06110 - exocyst complex component 3 (EXOC3, SEC6L1); Component of the Exocyst Complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACATCCCCAAACCCTTGCAACCTCCCTCCGCTGCTTTCCAACACAGC |
| Internal bar code: | ATCCAATGGCCCCCATGCAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 13.0435 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACCATACAGCTGCAACT |
| Suggested primer 2: | TGTCGTCACCATGGCATCAA |