Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.068781 |
Chromosome: | plastome |
Location: | 25555 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802275 | rps19,ChreCp013,2717056 | 30S ribosomal protein S19; (1 of 1) K02965 - small subunit ribosomal protein S19 (RP-S19, rpsS) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACATATCGTGGCCATGCTAAAAAAGATAAAAAAGCAAAACGTTAATTT |
Internal bar code: | CTGTGTCGGTCCAGTGCGTCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 159 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGATGGTAGTGGCAGCTC |
Suggested primer 2: | CTGCCACTGACGTCCACTAA |