Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.068797 |
Chromosome: | chromosome 8 |
Location: | 3595673 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379550 | MFT11,PHT4,PHT4-4,PHT4D | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 4) K08193 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), other (SLC17A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTCACAGTCGCCAGGGACCCGAAGACGTGGCGCCTGCACGCCACCGA |
Internal bar code: | CCGACGGCAAGGGCGAGGGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1199 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGTACCCAGTCTGCTGCA |
Suggested primer 2: | TGTACCCGCGTGTTTGAAGA |