| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.068912 |
| Chromosome: | chromosome 7 |
| Location: | 2254719 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327600 | (1 of 5) PF04366 - Las17-binding protein actin regulator (Ysc84) | 3'UTR | |
| Cre07.g327650 | SMM25 | (1 of 5) PF05572 - Pregnancy-associated plasma protein-A (Peptidase_M43); S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCGAATGCCTGGGATTCCGCCCTTCGCAGTACTCTCAAGGGCTGAAG |
| Internal bar code: | AAGTACGACTTTCCCGTGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1239 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGATGTCGGAGTTCCAAA |
| Suggested primer 2: | CCCCATCCACCCAACTAACC |