Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.068950 |
Chromosome: | chromosome 16 |
Location: | 8005957 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692116 | (1 of 3) PTHR23505:SF12 - MAJOR FACILITATOR PROTEIN | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCATGAACTTGTCTACTGCTTTGGCTCTCGCCCCGCCACTGTAGTTA |
Internal bar code: | TGTGCTCGTGGTGTGGGTTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5064 |
LEAP-Seq percent confirming: | 99.3197 |
LEAP-Seq n confirming: | 146 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 147 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTTGGACCCTGCCACCTT |
Suggested primer 2: | TGTTGACACCAGACGTCGAG |