Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.068967 |
Chromosome: | chromosome 10 |
Location: | 2577866 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g436650 | HEL45 | (1 of 1) PTHR24031//PTHR24031:SF181//PTHR24031:SF50 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 50 // DEAD/DEAH BOX RNA HELICASE FAMILY PROTEIN; DEAD/DEAH box helicase-related protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAGGACGGAATGATTACATAGCGATTGTGGGTGGGTACGGCGGGCA |
Internal bar code: | AATTCGTTACTGGGATCCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 542 |
LEAP-Seq percent confirming: | 72.2222 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATCGGCTGTGCAAATCAG |
Suggested primer 2: | CTGCTTCCACGTCGCAATTC |