Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.068978 |
Chromosome: | plastome |
Location: | 77194 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802295 | ChreCp030,psbN,2717031 | photosystem II protein N; (1 of 1) K02715 - PsbN protein (psbN) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTAAATCTGCTAGCGCAGGAAATAAATTTTATTCTATTTATATACTCC |
Internal bar code: | ACACATACAACTGCATGGAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 794 |
LEAP-Seq percent confirming: | 86.6667 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGACTTCGGTGCCTCTG |
Suggested primer 2: | AGGTTTACTTGCCCGACCAG |