Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.068986 |
Chromosome: | chromosome 13 |
Location: | 3772300 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588850 | (1 of 3) PF10250 - GDP-fucose protein O-fucosyltransferase (O-FucT) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCAGACATGACGGTGGTTGCGTTGGCCCTCATTGCGCTGGCGGCTCTG |
Internal bar code: | CTGGACAAGGTTACAGGTGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 480 |
LEAP-Seq percent confirming: | 23.5294 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTCGGTGAGCAGCTGATT |
Suggested primer 2: | AGCCAGGTACTCCGACATCT |