| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.068994 |
| Chromosome: | chromosome 1 |
| Location: | 1788692 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g009950 | NEP1 | NEP1-like protein; (1 of 1) 2.1.1.257 - tRNA (pseudouridine(54)-N(1))-methyltransferase / M(1)-Psi methyltransferase | 5'UTR |
| Cre01.g010000 | MAPK8 | Mitogen-Activated Protein Kinase; (1 of 1) K14512 - mitogen-activated protein kinase 6 (MPK6) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGCCCCATGTGTACTGAGGTCATGTCCACATAGCAACTAGTCAATAG |
| Internal bar code: | TCGGTCGGGGACGAACTGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1369 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCCTGACGCTGTGACTTC |
| Suggested primer 2: | AGAATAACGCCGCTCGAGAG |