Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069013 |
Chromosome: | chromosome 2 |
Location: | 1062911 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g080350 | (1 of 1) K11836 - ubiquitin carboxyl-terminal hydrolase 5/13 [EC:3.4.19.12] (USP5_13, UBP14) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTGGGTGCGTGGGTGGCAGGGAGGGTGCGGCCCTGCTTGGGCGCGTG |
Internal bar code: | TTGGCCGGGTGCAACTCTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 364 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGGCGTATCTCAAGATGGC |
Suggested primer 2: | CGAGGTGTTGGAAGGAGCTT |