| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.069087 |
| Chromosome: | plastome |
| Location: | 23930 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802274 | 2717055,ChreCp012,rpl2 | 50S ribosomal protein L2; (1 of 2) IPR005880 - Ribosomal protein L2, bacterial/organellar-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACACCAATTTTATCACGTCGAAAATCAATTTGACGATATAAACGTTTA |
| Internal bar code: | AAAAGAGGGGAACTGTCTCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 272 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGCCAATGCGTAGTTGA |
| Suggested primer 2: | CATGGTGTAACTGGACGGCT |