| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069089 |
| Chromosome: | chromosome 2 |
| Location: | 4982176 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110600 | DEG5 | (1 of 2) PTHR22939:SF99 - PROTEASE DO-LIKE 8, CHLOROPLASTIC; Deg protease | 5'UTR |
| Cre02.g110650 | (1 of 83) IPR029044 - Nucleotide-diphospho-sugar transferases | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCATGGCGGCACCAGGCTTTAAACGTTACTGGCGCAAGGGAAGCAGT |
| Internal bar code: | TAGGTCCCCAGAAAGAAACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2450 |
| LEAP-Seq percent confirming: | 22.2222 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGCATCTTGATGGCGCAG |
| Suggested primer 2: | CCCACACGATACCGGATCTG |