| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.069105 |
| Chromosome: | chromosome 3 |
| Location: | 7538947 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205300 | EXN7 | (1 of 1) IPR000104//IPR002562//IPR012337 - Antifreeze protein, type I // 3'-5' exonuclease domain // Ribonuclease H-like domain; 3'-5' exonuclease | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAAGCAGCGGCCGCTGACGCCTGCCATGATCGAGTACGCGGTGCAGG |
| Internal bar code: | CCCCGGCGAATGCACAGCAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 86.6667 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCTTCATCCCCTCCA |
| Suggested primer 2: | AGTACGACCAAATCACGCGT |