Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.069112 |
Chromosome: | chromosome 7 |
Location: | 3945040 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339600 | (1 of 19) IPR018392 - LysM domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCGGCAAGCAAACCGCCATCCTCCCGTAGACCCGCCCAAGCTCACA |
Internal bar code: | ATGTGCTATCGAATAGGTTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4700 |
LEAP-Seq percent confirming: | 95.8333 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTCATTTCTGCGCGAGGG |
Suggested primer 2: | ATGCGGCACTTGTAAGCTCT |