Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.069154 |
Chromosome: | chromosome 1 |
Location: | 45960 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g000150 | ZRT2,CrZIP2 | Zinc-nutrition responsive permease transporter; (1 of 6) K14709 - solute carrier family 39 (zinc transporter), member 1/2/3 (SLC39A1_2_3, ZIP1_2_3) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCATACATGCTTGTGTGCGAGTGATCGTCCTCACTGCTGCGGAAACGC |
Internal bar code: | GGGGGACTCTCATGGGGCGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4365 |
LEAP-Seq percent confirming: | 90.7895 |
LEAP-Seq n confirming: | 69 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACTGGGAAGGCGGTAACAA |
Suggested primer 2: | GCGGTAGATGTCAGCAGGTT |