| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069156 |
| Chromosome: | chromosome 7 |
| Location: | 3776030 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338451 | FBP1,GLPX1 | Fructose-1%252C6-bisphosphatase Type II; (1 of 1) PTHR30447 - FRUCTOSE-1,6-BISPHOSPHATASE CLASS 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCCCCCCGCCCCCCACGCACTCCTGTTGTTGTCCCACCCACACCCAT |
| Internal bar code: | CAGGGTTTCGGAATTGCCTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 137 |
| LEAP-Seq percent confirming: | 52.381 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTAGAAGCGGCATAGAGC |
| Suggested primer 2: | GATTTAGCAGCACGCAGTCG |