| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.069261 |
| Chromosome: | chromosome 17 |
| Location: | 6548311 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g744947 | (1 of 1) 2.1.1.230 - 23S rRNA (adenosine(1067)-2'-O)-methyltransferase / Thiostrepton-resistance methylase | 5'UTR | |
| lncRNA_TCONS_00240319 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGAATTAGAGCGCAGTCTTGGCACGCAAGTGCAAAGATGCAATCGGTA |
| Internal bar code: | TTAGATAAAATTTTACATTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1221 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTCAACAGGCGCCGAAAAC |
| Suggested primer 2: | AGCATCGTCCATGTCGTTGT |