| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.069288 |
| Chromosome: | chromosome 1 |
| Location: | 259133 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g001657 | DAB1,DNAAF3,PF22 | Dynein Assembly factor PF22; (1 of 1) PTHR22118//PTHR22118:SF14 - FAMILY NOT NAMED // DYNEIN ASSEMBLY FACTOR 3, AXONEMAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCACCTGGAACTTGAGCAGCGACAGGTCCAGCAGGGCAGCCAGCG |
| Internal bar code: | GGTACGGGCCATTTGATTTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 370 |
| LEAP-Seq percent confirming: | 73.6842 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACATCTCCCCACACCTCC |
| Suggested primer 2: | TGGTAGTCCCAGTCCACCAT |