Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.069301 |
Chromosome: | chromosome 12 |
Location: | 5541933 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g530700 | (1 of 1) K03126 - transcription initiation factor TFIID subunit 12 (TAF12) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCACGCACACTCCTGACTACGTTAGCGCCACTGCCGCGGCTGCCATCA |
Internal bar code: | ACGCGGGTGGATTAAGATGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2660 |
LEAP-Seq percent confirming: | 89.4118 |
LEAP-Seq n confirming: | 76 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCATTTCGCAGACGCTGG |
Suggested primer 2: | CTGCGCATGTATTTCCTGGC |