| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.069307 |
| Chromosome: | chromosome 7 |
| Location: | 1918947 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325748 | (1 of 1) 3.5.2.9 - 5-oxoprolinase (ATP-hydrolyzing) / Pyroglutamase (ATP-hydrolyzing) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGCCGGCCCCGCCAGCGTGTGGCCGGGCCGCAGGCTGTTGAGGTCGAA |
| Internal bar code: | CCAGGCATGTTTCGCAATTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 820 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGACCGCTCCCAGATCAC |
| Suggested primer 2: | ATGAAGTGAAGTGCCGACGT |