| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069337 |
| Chromosome: | chromosome 6 |
| Location: | 4651419 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278300 | (1 of 1) PTHR10926//PTHR10926:SF0 - CELL CYCLE CONTROL PROTEIN 50 // PROTEIN CHAT-1, ISOFORM A | 5'UTR | |
| Cre06.g278350 | AGD1 | (1 of 1) 1.3.1.78 - Arogenate dehydrogenase (NADP(+)) / TyrAAT2; Arogenate/prephenate dehydrogenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGAAGAAGAAGCCACAAAAGCAATTCAATCGTGCCCGCATGGTACTAG |
| Internal bar code: | AGCGACTGAGGGTAACTATCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1250 |
| LEAP-Seq percent confirming: | 96.0 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATTTCTGCCCCCTGACAT |
| Suggested primer 2: | CTACCCTTACGGCATCGGTC |