Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069344 |
Chromosome: | chromosome 12 |
Location: | 2346153 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508000 | TIC40 | (1 of 5) IPR006636 - Heat shock chaperonin-binding; Putative chloroplast enveloppe protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACAGGAATTCCCTGGCACTAATTTCTTCTCCCCTCTCTAGTTAGTT |
Internal bar code: | GATGGTCGATGAAGAACCAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 889 |
LEAP-Seq percent confirming: | 26.6667 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCTCCTCCTTGTAGGGAG |
Suggested primer 2: | GATTCGTCCAGAGCACAGCT |