| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.069372 |
| Chromosome: | chromosome 16 |
| Location: | 4499655 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667701 | (1 of 2) PF08660 - Oligosaccharide biosynthesis protein Alg14 like (Alg14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCCGAGCATTGCCCACTCCGCCTTCCGCTCTGGTCTGCGTACGCATT |
| Internal bar code: | GGGAGAGCGCTGTGCTAAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 1.78571 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCTGCGAACACCCCTTTC |
| Suggested primer 2: | TCAGTCGTCTAGGTCCAGCA |