| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.069380 |
| Chromosome: | chromosome 10 |
| Location: | 4760183 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452650 | TIM17 | Mitochondrial inner membrane translocase subunit; (1 of 1) K17795 - mitochondrial import inner membrane translocase subunit TIM17 (TIM17) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCACATCTGTCAGCACTGCCCCGAAGCATACCTCTCCGCACTGCCCCG |
| Internal bar code: | CATCACATGTCGCCTATTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1869 |
| LEAP-Seq percent confirming: | 95.2941 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGGTTGAGCGGTAGTCA |
| Suggested primer 2: | TCCATCATCGCGCTTACCTC |