| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.069418 |
| Chromosome: | chromosome 6 |
| Location: | 7300777 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299250 | 3'UTR | ||
| Cre06.g299300 | TUG,TUG1 | Gamma tubulin; (1 of 1) K10389 - tubulin gamma (TUBG) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATTTCGGCACGCATGTCGCGCACAGGAGGCCGTTGCGCGAATATGTTT |
| Internal bar code: | GATACTGAATTCGGGGGGTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 993 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAATCCCGCCCTACCGTC |
| Suggested primer 2: | GCTTCCCCTGTGGCTACATT |