| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069430 |
| Chromosome: | chromosome 7 |
| Location: | 5918182 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354100 | HAT4 | (1 of 1) K07739 - elongator complex protein 3 [EC:2.3.1.48] (ELP3, KAT9); Histone acetyltransferase 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCAGCATGGCACGTGTAGGCGCGAGCGGCTTTGGCTTATTCGGCTA |
| Internal bar code: | TCTTCATCAATTCGAACTGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 60 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGACGTGGACCTCAACCAG |
| Suggested primer 2: | TTCGTAGCACAGACAACGCT |