Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.069430 |
Chromosome: | chromosome 7 |
Location: | 5918182 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g354100 | HAT4 | (1 of 1) K07739 - elongator complex protein 3 [EC:2.3.1.48] (ELP3, KAT9); Histone acetyltransferase 4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCAGCATGGCACGTGTAGGCGCGAGCGGCTTTGGCTTATTCGGCTA |
Internal bar code: | TCTTCATCAATTCGAACTGAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 60 |
LEAP-Seq percent confirming: | 9.09091 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGACGTGGACCTCAACCAG |
Suggested primer 2: | TTCGTAGCACAGACAACGCT |