| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.069466 |
| Chromosome: | chromosome 2 |
| Location: | 97954 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073750 | KIN9-2,KLP1 | Kinesin motor protein; (1 of 3) K10397 - kinesin family member 6/9 (KIF6_9) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCTTGAACCTCTGGCACAGTTAACAAGTCCCCGATGCCCGACACCCCC |
| Internal bar code: | ATGAAGATTGGCTTGACTGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1337 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGTTGTGTCCGTGTTG |
| Suggested primer 2: | TTGAACGCGGCGATCAAATC |