Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.069475 |
Chromosome: | chromosome 13 |
Location: | 2707839 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g581750 | (1 of 3) K10752 - histone-binding protein RBBP4 (RBBP4, HAT2, CAF1, MIS16) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTCAACCTCTGCCAAAGCCGTGCCATACCGCTGGCTGACCCACCCGA |
Internal bar code: | AGAGGGGACAGTGAAGATCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 458 |
LEAP-Seq percent confirming: | 44.4444 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTACGGTAAACACACGCT |
Suggested primer 2: | CGAAGACGAGGACCCAGATG |