Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069530 |
Chromosome: | chromosome 1 |
Location: | 3443441 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g022350 | HEL3 | DEAH box ATP-dependent RNA helicase; (1 of 1) K14805 - ATP-dependent RNA helicase DDX24/MAK5 [EC:3.6.4.13] (DDX24, MAK5) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGCAAACACACGCCGTTGCAAGCCAGCTCCCATCTTGCCCCCCCCA |
Internal bar code: | GGGATAATCGTATTCCCGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 111 |
LEAP-Seq percent confirming: | 40.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGATGTGTGTGTGTGTGTGC |
Suggested primer 2: | CTCATGCGGTCAGGACAACT |