| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.069548 |
| Chromosome: | chromosome 2 |
| Location: | 2694061 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093450 | FBA2 | (1 of 2) PTHR11627//PTHR11627:SF20 - FRUCTOSE-BISPHOSPHATE ALDOLASE // FRUCTOSE-BISPHOSPHATE ALDOLASE; Fructose-1%252C6-bisphosphate aldolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAGTTGCTCTGGAGTGGCGAGACGCTACGACAACGCGCCGTTGTACC |
| Internal bar code: | GCGCACACGTTGTCGCCAGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 31.25 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTTCTGAAGCTGTGGTC |
| Suggested primer 2: | CACAGTGCCAGCTACCAGAA |