Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.069596 |
Chromosome: | chromosome 6 |
Location: | 5285466 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g284500 | RPH1,RNPH1 | 3'-5' Exoribonuclease PH component of the Exosome; (1 of 1) K11600 - exosome complex component RRP41 (RRP41, EXOSC4, SKI6) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCCGAAAGCGACTTGACTCATCCTCCGCGCACTGATCTCCTTGCTGT |
Internal bar code: | CGTTGACTAATTGTCTGTCGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 843 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCATGATGGTGCCACAAGC |
Suggested primer 2: | GGTATTCTCCTCCATGGGCG |