| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.069626 |
| Chromosome: | chromosome 2 |
| Location: | 5308787 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113050 | (1 of 2) PTHR23344:SF28 - GLYCEROPHOSPHODIESTER PHOSPHODIESTERASE 1 | 3'UTR | |
| Cre02.g113100 | (1 of 1) PTHR14154:SF3 - MITOCHONDRIAL PYRUVATE CARRIER 1 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGACGCACCAACGACACCCTTGATCCCGAAGTGTCATGTCGGCCAAT |
| Internal bar code: | CTAGAACCTGATACGCTAAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1008 |
| LEAP-Seq percent confirming: | 73.913 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGTTGCGTCACCCAAATA |
| Suggested primer 2: | GCTTGGAAGCGCGTCATAAG |