| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.069649 |
| Chromosome: | chromosome 7 |
| Location: | 3911335 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339150 | CPN60 beta2,CPN60B2 | (1 of 3) K04077 - chaperonin GroEL (groEL, HSPD1); Chaperonin 60B2 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGAAGTGGGGTTCCAGACACACAGGGGTTCTGGACACGGTCGTTGC |
| Internal bar code: | GGAAGATCGCTGGTTGTGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3257 |
| LEAP-Seq percent confirming: | 73.8739 |
| LEAP-Seq n confirming: | 82 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGGCACCATGCGGTTCTT |
| Suggested primer 2: | GATTGCCTGTTATGCCAGCG |