Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069649 |
Chromosome: | chromosome 7 |
Location: | 3911335 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339150 | CPN60 beta2,CPN60B2 | (1 of 3) K04077 - chaperonin GroEL (groEL, HSPD1); Chaperonin 60B2 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGAAGTGGGGTTCCAGACACACAGGGGTTCTGGACACGGTCGTTGC |
Internal bar code: | GGAAGATCGCTGGTTGTGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3257 |
LEAP-Seq percent confirming: | 73.8739 |
LEAP-Seq n confirming: | 82 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGGCACCATGCGGTTCTT |
Suggested primer 2: | GATTGCCTGTTATGCCAGCG |