| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069670 |
| Chromosome: | chromosome 17 |
| Location: | 4782867 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733208 | (1 of 2) K13091 - RNA-binding protein 39 (RBM39, RNPC2) | 3'UTR | |
| Cre17.g733250 | FKB16D,FKB16-4,FKB7 | (1 of 1) PTHR10516:SF323 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP16-4, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGCGGCACGTGTAACATATCTGTGAGCAAGCGTGTTCTGCGCGTCT |
| Internal bar code: | ATCCTCATTTAAGTCTATGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3912 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 97 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCACAGTCCGCAAATTGT |
| Suggested primer 2: | CACACCTTGCTTTGCACCTC |