Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069677 |
Chromosome: | chromosome 9 |
Location: | 4686444 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g402034 | UBA4 | (1 of 1) 2.7.7.80//2.8.1.11 - Molybdopterin-synthase adenylyltransferase // Molybdopterin-synthase sulfurtransferase / Molybdopterin synthase sulfurylase; URM1 E1 activating enzyme | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATGCACAGCACAGCGCGGGTGGGGCAGCACAAGGCGGCGTCCGGGCG |
Internal bar code: | TGCTCGTTTGAATGATCTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 793 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTGTGTGTGTGTGGTGA |
Suggested primer 2: | TCCCCCATCCATCTGTTTGC |