| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.069689 |
| Chromosome: | chromosome 3 |
| Location: | 9101466 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201327 | AKR1 | Aldo/keto reductase; (1 of 1) 1.1.1.188//1.1.1.283 - Prostaglandin-F synthase / Prostaglandin-F synthetase // Methylglyoxal reductase (NADPH) / Methylglyoxal reductase (NADPH-dependent) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGTTTGACCTCCGCCGCCGGGTCCGCCATCAGCTCCGCCACGTGGCG |
| Internal bar code: | TCAGTTGGGAGGCGGGTTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 203 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTATGTGAGAGGAGGGG |
| Suggested primer 2: | GGTTTCGTGATAAGCGTGGC |