Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.069725 |
Chromosome: | chromosome 6 |
Location: | 1990689 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g264950 | HTA13,HTA12 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCCAACCCAACACAATGGCTGGTCGCGGCAAGGGCAAGACCTCGGGC |
Internal bar code: | ATCCCGTCTAAAATCATGTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2624 |
LEAP-Seq percent confirming: | 93.3333 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGAACGATTGAGCAGGCT |
Suggested primer 2: | TTACGTCCCGTGTCAAGGTG |