| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069728 |
| Chromosome: | chromosome 12 |
| Location: | 6515931 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g537800 | RPL7 | (1 of 2) K02937 - large subunit ribosomal protein L7e (RP-L7e, RPL7); Cytosolic 80S ribosomal protein L7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGGAGCCATGGCGCGCTTCCCAAACGCACAGCGGGGCAAGAGGTACC |
| Internal bar code: | CGGGCAGTTTGGTGCAAAGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 804 |
| LEAP-Seq percent confirming: | 4.54545 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTAATCCCAGCACAGCCT |
| Suggested primer 2: | AGGGTTATTCAGCTGTGGGC |