| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069762 |
| Chromosome: | chromosome 12 |
| Location: | 2468916 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507400 | LCS3,CGL105 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | 3'UTR |
| Cre12.g507450 | SYP4 | Trans-Golgi network Qa-SNARE protein; (1 of 1) K08489 - syntaxin 16 (STX16) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCACACAACTCAAGCCCATTCACAGAGTACACACATACATTGCGGAC |
| Internal bar code: | TATACATAACAATCCAGTATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1403 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACCAGTCGCTCCTTCAC |
| Suggested primer 2: | TTACACAGGCGTTGCGTTTG |