| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.069794 |
| Chromosome: | chromosome 9 |
| Location: | 913340 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403150 | PWR9 | (1 of 14) PF04720 - PDDEXK-like family of unknown function (PDDEXK_6); PWR motif protein | 5'UTR |
| Cre09.g403200 | FAP198 | Flagellar Associated Protein 198; (1 of 1) PTHR21281//PTHR21281:SF0 - UNCHARACTERIZED // CYTOCHROME B5 DOMAIN-CONTAINING PROTEIN 1 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTCAGAGCTGATAGAGAGCCATATCACTTGATTTTGCTGTCGCGGCGA |
| Internal bar code: | GCACCCAGTCGGTTCCTCACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1768 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTATCTCCGCAGTGGCC |
| Suggested primer 2: | AACAACTGCGGGTCCTGTAG |