| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.069795 |
| Chromosome: | chromosome 3 |
| Location: | 9024929 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g202897 | UBC34 | E2 ubiquitin conjugating enzyme; (1 of 1) K10578 - ubiquitin-conjugating enzyme E2 J1 (UBE2J1, NCUBE1, UBC6) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGAGTACTTAGCGCTGTAAAGCTGACTTAGGCAGTACTATCTTGGGA |
| Internal bar code: | GCACTTGATTGGAAACTGGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4481 |
| LEAP-Seq percent confirming: | 72.1311 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGAGGACGTATAACCCTG |
| Suggested primer 2: | GCGTGTGATAAAAGCGCGAT |