Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.069818 |
Chromosome: | chromosome 14 |
Location: | 3931964 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632831 | (1 of 31) IPR016187 - C-type lectin fold | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCACCCCGCAGGCAAGGCTTACACACGCGCAAGGACAGCGCTATCCC |
Internal bar code: | CTAAGTTAAGACCATGCGAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 433 |
LEAP-Seq percent confirming: | 92.8571 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTCCTGACACGGACGATG |
Suggested primer 2: | GTGTCCATCCATGCTGTCCA |