Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.069832 |
Chromosome: | chromosome 11 |
Location: | 358552 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467577 | (1 of 2) PF00319 - SRF-type transcription factor (DNA-binding and dimerisation domain) (SRF-TF) | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAACAAACTAAGAGTCAGGGCTGCTTGTTCTACTTGTTCTACTACTAGA |
Internal bar code: | TGCGGCTCGTTCATGATTTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2916 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 55 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACAACGAGAGGTCAAGGA |
Suggested primer 2: | AAGTCAACGAGTCCCGAACC |