Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.069873 |
Chromosome: | chromosome 7 |
Location: | 5629528 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g352350 | FHL7,FTSHI6,FHL3,FTSHi6 | (1 of 6) K03798 - cell division protease FtsH [EC:3.4.24.-] (ftsH, hflB); Chloroplast-import FtsH-like ATPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTGGTGGTGGTGGACGGCGGCACGGGCGCAGTTGGGGTGGCAGGGGC |
Internal bar code: | TATGGATTCGCCGGTGAGCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 303 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCACGCCTTGACTTCTGA |
Suggested primer 2: | TCCACCACCAACAGCCATAC |