Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.069880 |
Chromosome: | mitogenome |
Location: | 4430 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreMt.g802339 | nad5,ChrepMp03,801492 | NADH dehydrogenase subunit 5; (1 of 1) K03883 - NADH-ubiquinone oxidoreductase chain 5 (ND5) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACTAACACGGTTAACCAAAATGGCTTTTTGAGCACTTTTAACGGCGGA |
Internal bar code: | TCTGTCATCTGTGATTCAATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 174 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACCACCGAATAGGGCTGG |
Suggested primer 2: | AGCACTGTGAGCACTACCAC |