| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069884 |
| Chromosome: | chromosome 13 |
| Location: | 1774636 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574800 | CYB5-3,CYB3 | (1 of 3) K00326 - cytochrome-b5 reductase (E1.6.2.2); Cytochrome b5 flavohemoprotein | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTCTTCTCCCGTACACTAGAGCACCCGTATCAACACGAGTCGCACCA |
| Internal bar code: | GACAAGTTAACTGACGACTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3541 |
| LEAP-Seq percent confirming: | 99.0909 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 110 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGTTCACACAAGCTGG |
| Suggested primer 2: | ACAGGCCAAAACCCCAGAAA |